Coleopterists Corner

Cicindela Species Delimitation

2011-12-13T10:32:00.002-06:00

What is a species? This is a question that every new biology grad student seems to get fixated on at least for a while. Personally I found the book by Jody Hey: “Genes, Categories, and Species: TheEvolutionary and Cognitive Cause of the Species Problem” to be a satisfactory and sufficient exploration of the topic. After reading the book, I came to the conclusion that for me (I am purposefully ignoring viruses and bacteria) species are something which exist in nature, they are groups of organisms that all share an evolutionary trajectory. Because we cannot travel to the future the true boundaries of species are inherently unknowable. Names are something else. To me names are things we give to organisms that allow us to intelligibly discuss relatively discrete groupings of populations.

Unfortunately, no simple scheme for assigning ranks and names to taxa can deal with the reality of biological processes. I think a perfect example of this was a recent paper: “Species designation of the Bruneau Dune tigerbeetle (Cicindela waynei) is supported by phylogenetic analysis of mitochondrial DNA sequence data” Cicindela waynei is a geographically isolated species which was described like most species based on morphological evidence for differences between it and its closest relative the more widespread C. arenicola. This new paper looked to molecular evidence (mitochondrial) to see if it was congruent with the morphological evidence.

The authors of the paper believe their study shows support for the naming of the species and even show some support for the idea that this species may have arisen due to isolation after late Pleistocene flooding events (cool story). I really don’t have any argument with any of this (though nuclear loci would have been nice). The problem is elevating this population to species status does not reflect the fact that in their analysis they did not find reciprocal monophyly.

Reciprocal monophyly is what you would hope to see. It makes for a nice clean picture and a clear decision. If they had found it the phylogeny of all of their populations would have looked like this:

However what they did find was a topology like this:

Here we see the new species is actually nested within the arenicola. To me elevating its taxonomic rank to the same level as arenicola actually reduces the value of the names because they no longer reflect the closeness of the association between the two putative species. My first thought is maybe this is a good example of when subspecies (my least favorite classification) actually makes sense. Perhaps what we are seeing is incomplete lineage sorting or as the authors suggest maybe some of these other populations should also be broken out into separate species. I don’t know what the right answer is but I don’t think this data is necessarily clear support for species status of the Bruneau Dune population.

Despite my issues I did enjoy the paper and its always fun to think about how we should classify populations and the kind of hypothesis that we can really support with our limited information.

Hope everyone has a great holiday!

Better Pictures of Tribolium

2011-11-03T10:38:00.000-05:00

With a little more practice and the judicious use of dye and photoshop I was able to get these shots. I really like the way that you can see the developing eggs in the female. Too cool. I am almost done applying for the NSF GRFP and I will have more blog posts at that point.

Dissecting Tribolium Genitalia

2011-10-12T16:30:00.002-05:00

For the past couple of days I have been working on figuring out how to dissect the testes from Triboloium castaneum. I need the testes for a FISH project for my advisor and also for some future karyotype projects of my own. It took a quite a bit of trial and error so I wanted to give everybody a run down on how I did it just in case someone else out there is struggling through the same difficulties.

Equipment and Solutions

1.Fine tip forceps (2)
2.Needle probe (2)
3.Deep well slides (2)
4.Farmer’s fixative
75 ml ethanol
25 ml glacial acetic acid
5.Insect Saline
100 ml distilled H2O
0.9 g NaCl
6.Ethanol

Protocol
1.Beetles should be held on ice for 10 minutes prior to dissection.
2.Place the beetle in a drop of insect saline solution on a depression slid.
3.Orient the beetle so that the ventral side is facing up.
4.Using broad forceps apply increasing pressure to the metasternum.

This pressure will cause the abdomen to begin distending and the 8th sternite as well as part of genitalia will evert.

5.Grasp the everted genitalia and gently pull away from the beetle.

When this is done you will normally get the majority of the reproductive system separated from the beetles abdomen. Sometimes you also get a portion of the digestive system attached to the genitalia. If the gut pulls away with the reproductive system it is easy to recognize by the attachment of the darkly colored Malpighian tubes as well as the wider and rougher midgut. If the gut is present, it can be gently pulled away from the reproductive organs. In males it is common for one or both of the testes to remain in the abdomen when the rest of the reproductive system is pulled away. If this occurs, you will have to dissect the abdomen to remove them. The testes are approximately .6mm in diameter and are usually lightly attached to the ventral side of the 7th abdominal segment and are easily teased away. Each testis is made up of 6 globular testicular follicles which are tightly attached to the vas deferens.

6.Use the needle probes to remove excess tissues that are stuck to the genitalia by gently agitating the tissue or the solution around it.
7.Once the structures of interest have been isolated they can be moved into the fixative.
8.Tissues should be soaked in the fixative for 5 minutes.
9.Move tissues into ethanol and refrigerate.

Once in ethanol the tissue should remain viable for a number of months or even years if refrigerated.

Here are three pictures of what you will actually see when you start pulling the genitalia out. The pictures are my own while the line drawing is from the Biology of Tribolium Volume I by A. Sokoloff.

Free Pictures

2011-08-05T15:11:00.001-05:00

I have added a picture page to my blog. I put this here as a simple way for me to have a copy of all of the beetle pictures that I have taken that I might want to use in slides for classes presentations or on web pages. All of these pictures are my own work but I have chosen to make them available to everyone with a Creative Commons Attribution-Noncommercial-ShareAlike license. This basically means that you can use or alter these pictures as long as you aren't trying to make money off of them, are willing to share what you make from them and if you use them attribute their source. My hope is that they will be useful to people who are teaching biology courses of some sort. Today I added two shots of a Lampyridae. Happy Friday!!

Fun Friday Beetle

2011-07-29T13:16:00.005-05:00

No time for a full post today but here is a beautiful little guy to satisfy your Coleoptera cravings till Monday. A nice series of these guys came to the black light in SE Texas a couple of weeks ago. I would love to know how the beetle benefits from having such dense and relatively long setae. I haven't keyed this guy out but his overall appearance makes me think that he will by Staphylinidae in the subfamily Scydmaeninae.

Beetle Anatomy

2011-07-27T18:01:00.005-05:00

Insects exchange gases through a respiratory system that is made up of spiracles, trachea, and tracheoles. Spiracles are the openings to the atmosphere and they connect to the trachea and eventually tracheoles. The tracheoles are the smallest tubes of the arthropod respiratory system and are the site of gas exchange. The concentration of trachea and tracheoles is highest in those tissues that are most metabolically active like the alimentary canal. The two pictures below show the branching trachea found supplying the alimentary canal of a Tenebrionidae larva.

Trachea supplying the alimentary canal

Coleoptera Trachea

To get these pictures I dissected the larva by first submersing it in insect saline solution which is made by mixing .9 grams of NaCl with 100 ml of distilled water. I then used micro-scissors to slice open the dorsal side of the body and minuten nadelns to hold the sclerites away from the body so that the internal organs could be seen. For my first dissection of a small larva I feel that it went well.

These pictures were taken as part of my goal to build up a collection of photos that I can use in teaching entomology in the future. I used the same Nikon SMZ1500 scope with a Nikon Digital Sight DS-Fi-1 camera to take these photographs that I use for almost everything on this blog. As always I used gimp and combine ZP for the editing process.

Davy Crockett Collecting Trip

2011-07-26T16:10:00.008-05:00

I recently made a short collecting trip to Davy Crockett National Forest. The weather was not ideal it rained intermittently and when the rain stopped the moon was out in full force. None the less the black light did bring in a few interesting things including a couple of beautiful extra large Strategus. However, some of the little things were just as amazing like this small dytiscidae belonging to the genus Thermonectus.

Looking at this guy under the scope reminded me of the evolutionary novelty that beetles exhibit that has always been a source of wonder to me. The protarsi of some male Dytiscidae like this one have an amazing array of suction cups that increase the gripping power of the beetles front legs. Most books say that these are used to allow the male to grasp the female during mating. This seems like a plausible explanation though I could not find any publication of an experiment actually testing this idea. Whether it is important in mating or in prey manipulation it is none the less an amazing structure to evolve in an organic form.

A lot of other beetles with aquatic affinities showed up like this Limnichidae with really cool pronotal excavations for the antenna. The species on this one is Physemus minutus. Thanks to the bug guide users who helped me on that identification!

This close up shows a slightly better angle and enlargement for both the excavation that receives the antenna and the setae filled pit in front of the eye.

Another Limnichidae that I have not yet identified has an amazing suit of iridescent bronze and silver setae.

The carabid Tetragonoderus (peronoscelis) latipennis also showed up at the light. This beetle behaves much like a nocturnal tiger beetle often hunting along sandy shores at night. During the day they normally are hidden in leaf litter.

Lots of other interesting but small guys came to the light so if I cant get some IDs I'll have more to post.

Slime Flux and Identifying Nitidulidae

2011-07-01T12:02:00.005-05:00

Lobiopa insularis and a typical slime flux

I am working on a project this summer to document the beetles that make use of slime flux habitats. These are wet tree wounds that are unable to heal over due to infection by numerous bacteria and fungi that are toxic to the wood. Because of this they can last for many years and provide a great habitat for many diptera and coleoptera.

Very little work has been done on this habitat. Sokoloff discussed what he found in this habitat and compared it to the species collected in bannana traps. However, his work was all done in one place during one summer in California. Furthermore, his focus at the time was primarily on Drosophila. In the realm of beetles there have been a few papers that mentioned the habitat as the obligatory niche for Nosodendron unicolor. As well as a cursory description by Brett Ratcliffe from 1970 saying that he collected a great assortment of beetles at a slime flux in Japan. I decided that documenting beetle diversity in this habitat would be a good side project to work on this summer and it gives me an excuse to do some extra collecting.

As much fun as the collecting is the real work is in identifying all of the specimens that I am finding. Not surprisingly one of the most common families that I have been running into is Nitidulidae. To identify these guys I am starting out with the key in American Beetles this gets me to the genus but from their it is a bit tougher. Below are the references that I have been using with some success. If you have any pointers to an important paper that I have missed please let me know.

Parsons, C.T. 1943. A Revision of Nearctic Nitidulidae (Coleoptera) Bull. Mus. Comp. Zool. 92(3):121-278

Parry, R.H., H.F. Howden. 1975. A New Species of Colopterus from Florida (Coleoptera, Nitidulidae) Coleopterists Bull. 29(4): 275-279

Connell, W.A. 1984. Nearctic Nitidulidae-synonymy and additions since Parsons' revision. Coleopterists Bull. 38(2):160-164

Cline, A.R. 2003. A new sap beetle (Coleoptera: Nitidulidae) to the United States with a revised key to the Camptodes Erichson occuring in America North of Mexico.

Connell, W.A. 1977. A key to Carpophilus sap beetles associated with stored foods in the United States. Cooperative Plant Pest Report 2: 398-404.

Also the websites:

Nitidulidae in the Mississippi Entomological Museum

and

Kateretidae and Nitidulidae of Wisconsin

Onthophagus

2011-06-29T14:00:00.005-05:00

Here is one more attempt at photographing and doctoring pictures of pinned beetles the tools used are the same that I have discussed in previous posts and the beetle is a dung beetle in the genus Onthophagus (I presume O. tarsus).

Cool Pselaphinae

2011-06-28T15:27:00.002-05:00

The staphylinid subfamily Pselaphinae is a species rich group of roughly 9,000 species. This subfamily was once considered a family of its own. The life history of Pselaphinae are poorly known though most are thought to be predaceous. Pselaphinae are called ant-loving beetles because many species are inquilines of ant nests but many other species are found in leaf litter and other organic detritus. The one pictured below was extracted from a berlese funnel loaded with decaying wood. The wood was from a local park in Arligton, Texas. The photo was taken using a microscope in our lab and the attached nikon ccd. Once I took the picture I followed a lot of the directions that were given in a recent article in the Scarab Newsletter by Jocelyn Gill
. She does a great job describing the process that she uses to producer her photos for Henry Howden. She describes the whole process step by step in Photoshop. However, I was able to follow along and do most of what she mentions using GIMP.

Kemper Museum of Art

2011-06-09T23:58:00.003-05:00

An arachnid statue at the museum next door to the Arthropod Genomics Symposium

Finding Genes - Day 2

2011-06-09T23:20:00.003-05:00

Today there was a talk that I had really been looking forward to. It was by David Schlipalius a scientist with the Queensland Government. His presentation focused on the identification of the genes responsible for phosphine resistance in Tribolium castanium. He used bulk segregant analysis of SNPs. This is a great method that takes advantage of advancements in high throughput sequencing.

His team collected a pair of beetles from a population known to exhibit phosphine resistance and began line breading them. After 4 generations these beetles were split into two pools. One pool was exposed to phosphine and 20 of those that survived were pooled and sequenced. The other pool of beetles were sequenced without testing for phosphine resistance. The idea behind this method is that the gene of importance will be segregating in the untested population but fixed in the selected population. This means that you can compare the SNP frequency in the two pools ideally you would see 100% in the tested population and some smaller frequency in the untested population.

The actual picture that you get when you look at the data can be a bit more complicated. It ends up that at least in this case there are a lot of random SNPs that segregated in one pool or the other to avoid this complication he used a sliding window analysis with a width of 300 bp to identify regions that are important in the phenotype of interest.

The end of this story is that David and his group were able to identify 2 loci responsible for the posphine resistance. As an added benefit this research even helped improve what we know about the Tribolium castaneum genome. It ends up that the one of the SNPs mapped to one of the unassigned contigs. Thanks to this research we know exactly were this contig belongs.

Today was the last day of the International Tribolium Meeting and tonight we had the opener for the Arthropod Genomics Symposium Meeting. It was opened up with a talk by Kevin Hackett from the USDA he talked about the strategy behind the 5,000 arthropod genome project. This was kind of a cool speech. No power point or anything just 30 minutes of what he thinks we could gain by banding together and organizing our efforts as much as possible. He ended it with a couple of sci-fi refs which is never a bad thing.

International Tribolium Meeting

2011-06-09T00:52:00.000-05:00

Lots of great science today! The range was broad and included topics like limb regeneration, wing morpholpogy, sexually antagonistic selection, codon bias and sex determination. I really enjoyed the presentation by Yoshi Tomoyasu who showed the changes in tribolium hind wing veins produced by knockouts (RNAi) of a number of genes. He has some cool ideas about the development and evolution of wings.

However, by far my favorite talk was from Daniel Bopp from the University of Zurich. He discussed what he has uncovered about the determination of sex in coleoptera (tribolium). His results showed that much of the same machinery seems to be used in tribolium as is used in drosophila, with some signifigant changes for instance in sxl. What was really exciting to me was that his talk gave me some ideas about what might be underlying the odd distribution of sex chromosomes in coleoptera.

Fun first day at my first conference!

Summer Conferences

2011-06-07T07:39:00.003-05:00

I am going to two conferences this summer the first is Arthropod Genomics and the second is Evolution. I will be presenting some of my initial findings concerning karyotype evolution in Coleoptera at the Evolution conference. At this first one (arthropod genomics) I am just going to be a spectator. That is actually ok with me since I have never been to one of these before it will give me a chance to see how things work before I have to actually present something later this month at Evolution.

I think that Arthropod Genomics will be pretty cool. We are going to have two days of just Tribolium talk (it’s the model organism in our lab) and then the rest of the time will be broader with people studying everything you can imagine. It will also be nice to meet more people and be able to start connecting faces to all the names that I read in papers. I hope to make posts most days giving a recap of the most interesting research that I hear about. I'm off to Kansas City.

More Free Stuff

2011-06-04T10:32:00.002-05:00

MacClade is Free!

David and Wayne Maddison the developers behind MacClade and Mesquite are shifting their efforts away from MacClade which will not work under MacOS X Lion. Because of this they have decided to release MacClade for free. This a great phylogenetics software that is largely gui driven and is a little easier to learn than some of the more common command line only alternatives out there. The manual by itself is actually a pretty handy resource since it includes a lot of theory as well as examples.

http://macclade.org/download.html

"Ardent Beetle-hunters"

2011-06-03T15:44:00.003-05:00

I read an interesting paper from this book today. The book Natural Selection and Beyond: The Intellectual Legacy of Alfred Russel Wallace looks like a really great collection of papers. I feel like I know as much about Wallace as your average biologist but looking at the table of contents and reading the introduction shows me that there was a lot more to this man than what we often remember.

Thanks to the generosity of the author (Andrew Berry), I have read the first paper “Ardent Beetle-hunters”: Natural History, Collecting and the Theory of Evolution. The title of the paper comes from a speech that Wallace gave on the 1st July 1908 at a meeting of the Linnean Society. Wallace credited this commonality between he and Darwin as being key in their independent development of natural selection as the process driving evolution. The author points out that both of these scientist were more than just your typical naturalists. Wallace and Darwin were gifted and were able to learn to recognize an amazing breadth of biological diversity with great rapidity. Both naturalists also had the experience of learning a limited temporal fauna which could act as a framework for organizing the vast number of new species they would discover when they traveled. I think that Wallace makes an important point in his speech when he says that he and Darwin were “collectors ... of a speculative turn of mind...constantly led to think upon the why and the how of all this wonderful variety” This ability to ask the right question is so important in science. Often a groundbreaking research begins not as an amazing epiphany but an insightful question that you struggle to answer. That struggle which in the case of natural selection lasted for years with Darwin can then lead to an amazing epiphany.

Berry's conclusion is that it was the fortuitous combination of a natural gift, exposure to a diverse group organisms (beetle collecting) and an ability to synthesize information that led to the great discoveries of Darwin and Wallace. Berry also reminds us that this pattern is not unique it is the pattern of a number of great biologists like E.O. Wilson and Ernst Mayr.

Finally the paper includes a quote that I love. It is from T.H. Huxley who after reading Origin said “How extremely stupid not to have thought of that!” If a scientist like Huxley can feel that way then maybe I should feel a little better as I struggle to come up with an amazing groundbreaking dissertation topic.

FREE BOOKS

2011-06-02T18:48:00.003-05:00

The National Academies Press is making a great many of their titles available free as PDF files. For a poor grad student like myself this is awesome. I have already downloaded my first book: Systematics and the Origin of Species: On Ernst Mayr's 100th Anniversary. The site also has a lot of other really good books like the In the Light of Evolution series. I hope you find something good to read.

Comps

2011-06-01T11:02:00.002-05:00

I will sit for my comps in a little less than a year. At my school PhD comps include a written and a oral portion. About six weeks before the big date each person on my committee of five professors will give me two questions. In theory one of these will be closely related to my own research interests while the other will be a broader question. I'll have a few weeks to compose my answers to these questions which I will then return to my committee members. After they have had a chance to review my answers we will have the oral portion of the exam. Lately these seem to run around two hours. The questions that you are asked in this portion can be over just about anything but usually are weighted towards the students research interests.

To get ready for this I have made up a reading and study list to try and make sure that I know everything that I personally feel a person with a PhD in biology should know. I am probably over doing it but when else am I ever going to get to study so much across such a broad range of topics. Since I have a full year to prepare I can really cover an amazing amount of information.

Each morning I am reading and summarizing two article from my reading list. My list has about 250 articles plus another 40 or so book chapters. I put it together from reading groups and classes that I have had over the last year as well scouring a lot of online resources like:

http://ib.berkeley.edu/courses/ib200a/IB200A_Readings.shtml

http://www.webpages.uidaho.edu/~lukeh/GiantsOfEvol.html

https://blogs.rochester.edu/EEB/?p=339

(I'll post it later this week once it is cleaned up and alphabetized)

I am also reviewing Campbell and Reece a few hours each week. My main goal with it is to be able to explain most of the real groundbreaking experiments that allowed us to reach the level of understanding that we have today. I also feel like it covers some of the basic processes that are outside of my research area but that I should still be able to explain to someone else (photosynthesis, gene regulation, etc.)

On the entomology front I am reading two books. Each evening I read either Biology of Coleoptera by Crowson or The Evolution of Insects by Grimaldi and Engel.

I hope that this level of preparation is a bit more than most at my school and that it will allow me to fly through comps with no problem. I'd love to hear how anyone else who has already been through this process prepared for comps and how you felt about it once it was all said and done.

Looking at Coleoptera Phylogeny with 180,000 Morphological Data Points

2011-05-23T14:26:00.004-05:00

What I think will prove to be an extremely important Coleoptera paper was published in volume 61 of the Annales of Zoologici. The paper is titled: Phylogeny of the Coleoptera Based on Morphological Characters of Adults and Larvae. This paper is the product of a collaboration by some of the top coleopterists in the world today: J.F. Lawrence, A. Slipinski, A. Seago, M.K. Thayer, A.F. Newton, and A.E. Marvaldi. This is one of the products produced by the BTOL project and is the result of scoring 359 beetle taxa for 516 morphological traits.

There has been a legitimate question as to whether it is possible to use morphological data to recover the patterns of evolution in a group as old and structurally diverse as coleoptera. The authors come to the reasonable conclusion that morphological data does have the power to resolve much of the phylogeny of coleoptera. In particular recent branching events were recovered with high support. However, the large amount of homoplasy across the larger data set produced two troubling results. One was yet another hypothesis for the relationship between the four extant suborders (the authors remind us that brings the recent total to eight), and the second was a propensity for taxa that are widely accepted as having a sister group relationship to a larger clade showing up as part of a subclade with the most derived members of the larger clade. The authors ascribe this to homoplasy and discuss the difficulty in assigning ancestral state for many traits that simply can't be scored in outgroups (wing folding for instance is largely absent in the Coleoptera outgroups).

I think that the authors make an accurate prediction of the importance of their paper to the incorporation of fossil data. With existing phylogenies like Hunt's 2007 which is based on molecular data it is very difficult to place fossils and calibrate our trees. However with a robust morphological data set we should be able to much more precisely place fossils within the beetle tree of life. Being able to constrain our trees in this way will make the margin of error involved in other analyses that much smaller and more likely to uncover interesting patterns.

Finally the authors provide us with an amazing resources of great images of the characters chosen for their analysis. The authors state that these images will be available in Morphbank. This would be great since they will probably be available for use for “private, education, research or other non-commercial purposes for free, provided that the source and the copyright holder are cited” I was unable to locate the images on Morphbank by DOI, species names, Authors, etc but hopefully they will get submitted and become available.

Thumbnail view of a section of the PDF showing the abundant high quality figures

The authors end their paper with a promise of an integrated paper that will bring together all of the morphological and molecular data that has been collected within the guise of the BTOL project. I really look forward to that one!

If you have access to bioone then here is a link to the full paper.

If not here is the abstract

Structural Changes in Chromosomes

2011-05-18T11:01:00.003-05:00

Changes in the structure of chromosomes can have important impacts on an organism. Many different processes can produce structural changes. Today I am only going to discuss the outcomes of these processes and the possible impact that these changes can have on an organism.
Duplications of a short segment of a chromosome are frequent events and can have important fitness impacts. When a duplication first occurs it creates two regions on the chromosome that are homologous to the original duplicated region. Having multiple areas of homology increases the probability that processes like unequal crossing over will occur and thus the future stability of the region. Segmental duplications have also been associated with disease phenotypes like autism.

Inversions and translocations have similar effects in reducing the ability of chromosomes to recombine with their homologous partners. Because of this both of these types of changes may increase the propensity for divergence to occur in the effected regions. This could be especially important when we begin to consider adaptation to the environment and how to avoid being swamped by the original genotype.

Spotting an inversion when you are looking at a DNA sequence isn't as easy as just looking for something that is backwards in comparison to the reference sequence. If this is our reference sequence:
ACCATCGCTATCACAGAGTCAAC
and the red portion undergoes an inversion it will not produce the sequence you might first expect:
ACCATGAGACACTATCGCTCAAC
This would require that 3' ends be joined together which is not possible. Instead the red portion that is being inverted will be replaced by the inverted complimentary sequence. Our new sequence then will be:
ACCATCTCTGTGATAGCGTCAAC

Translocations can have a major impact on the fitness of an organism since some gametes can have multiple copies of a gene while others may not have any copies of a gene. The ability of translocations to produce gene duplication is extremely important since we now know that gene duplication is probably the primary source for new genes.

Sexually Antagonistic Selection

2011-05-17T17:02:00.003-05:00

When male and females achieve their greatest fitness by having different values for the same trait sexually antagonistic selection is expected to occur. Quite frequently traits are not found in isolation but are actually manifestations of gene networks controlling multiple traits. These gene networks may be difficult to disentangle. A number of outcomes are possible in cases were males and females benefit from different trait values. The possibilities for what may occur during sexually antagonistic selection can be expressed on a continuum. On one end of this continuum would be divergent selection in the two sexes setting up an equilibrium trait value that balances the fitness effect of the trait both sexes. On the other end of the spectrum would be a system where the expression of a trait has been completely decoupled from other traits and expression in the two sexes is completely isolated.

The degree that sex specific trait expression occurs is directly observable through the frequency of sexual dimorphism in species traits. However, the frequency or ease of decoupling of the trait of interest from other related traits is unclear. This final question is the topic of an interesting paper in Current Biology by Harano etal.

They had a simple but informative experiment which used selection lines for larger and smaller mandibles in the males of the pest beetle Gnatocerus cornutus. Large mandibles provide increased fitness for males which use them in fighting and securing mating opportunities. The species is obviously dimorphic with females having very small mandibles approximately 1/6 the length of males. After 12 generations of selection the females of each group were assayed for fitness by breeding with control populations. The graph below shows that selection for long mandibles in males was detrimental to female fitness and that selection for short mandibles was beneficial to female fitness.

Diagnostic Evaluation

2011-05-17T16:46:00.003-05:00

Well I have completed my first year of my PhD program and I have gotten my diagnostic evaluation out of the way. For those not familiar with it a diagnostic evaluation (at least at my school) is your first meeting with your full committee (5 professors). The diagnostic evaluation has several purposes. First it is to plan out your coursework requirements for your degree and insure that they are in line with your research interests. Before the meeting you draw up a plan of coursework to address any deficiencies from your undergraduate training and to prepare you for your particular research and career goals. You also use this time to present a timeline for the completion of your PhD and some preliminary information about what you plan on studying for your dissertation. This went quite well for me. All of my committee members agreed to meet on the first day that I offered, and they were all accepting of my plans for my course work. We actually didn't spend nearly the amount of time on my plans for course work that I thought we would. Instead we spent a lot of time talking about beetles!!! Always good for me! Anyway I told them that I would like to take my comps this time next year so I am now working on a plan to be ready for that! Because of that I am probably going to start making a lot more post that just explain some cool biological phenomenon. I find that the process of writing up a post to be a really good way to nail down an idea.

Lessons from teaching an intro entomology lab

2011-04-24T19:57:00.004-05:00

With the exception of a little grading I am done teaching the intro entomology lab for the spring semester. This also marks the end of my first year as a graduate teaching assistant (GTA), and my transition to working as a research assistant for a couple of terms. I have the lofty goal of not just being an assistant professor but actually being one of those who is tough but at the same time engenders interest in the area that I am teaching by sharing my own excitement. To this end I am trying to keep track of the many mistakes that I am making as a GTA. Hopefully I can iron out all the kinks before I am actually in charge of one of those big lecture halls with 100 plus student.

So what did I learn teaching this intro to entomology lab? First off the freedom that I was give was both a blessing and a curse. I spent far more time teaching this class than I did last semester when I taught intro biology lab. With intro biology we have a lab manual and specific experiments to perform each week. With entomology I was told that the lab should primarily focus on identification of different common groups of insects. I was given a list of orders to cover guidelines for a collection and told to give one quiz and a practical. Beyond these broad instructions I was free to run things as I saw fit. This freedom was great for me. This is a subject that I love and I was given a chance to explore the best way for me to share this field of study with my students.

That freedom also meant that this semester was something of a learning process for me. I have tried to identify five things that I think were especially important that I learned this semester. Maybe by sharing these observations I can help someone else I know that remembering them will help me.

1. Anatomy has to come before anything else!
Basic anatomy was supposed to be covered in the lecture portion of the course so I didn’t worry about it much at first. This was a huge mistake. When I teach this class again someday I will spend the first couple of weeks really teaching anatomy and comparing anatomy among groups. Being able to label a diagram is different from being able to interpret characters under a dissecting scope.

2. Prevent procrastination.
Students will procrastinate if there is any possible way to do so. Should a professor design a course so that it is easy for students to put stuff off to the last minute? I guess we all have to answer that question for ourselves but I would say no. We should try at least to set our students up to succeed. I believe that you can still have a course with just as much rigor but with checkpoints on large assignments and frequent assessments that allow students to measure their own understanding.

3. Developing a consistent “style” or “pattern” of presenting information.
I was trying to think of some way to create some continuity as we jumped from order to order each week and I remembered the famous title of an article written by Dobzhansky his article was titled “Nothing in Biology Makes Sense Except in the Light of Evolution.” From that point on I tried to stop giving the class a list of traits that this group or that group had and instead I tried to get the class to see why the characters unique to a group were really cool evolutionary changes. This made it a lot easier to be excited about teaching the information and hopefully made it a little easier for students to remember. Obviously this task was a lot easier for the groups with which I am most familiar with. However I believe that starting with this idea from the beginning will really improve this course or any other course that I teach in the future.

4. Make it simple… no utterly clear… even clearer.
What is simple and straight forward to us in our own minds is often completely obfuscated when presented to others. This has come up a lot over the past year. (For the record I speak clearly, with sufficient volume, and I am on the whole normally considered a good communicator.) A perfect example would be my first practical. I had stations set up throughout the room and told the student to work through them until they were finished. This resulted in a huge traffic jam as apparently all student put off the same few stations to the end. The next time I told the students to find a numbered station and when I instructed them they were to move to the numerically next station. Foolproof right? WRONG. Again traffic jams people wanting the same spots etc. etc. Finally I taped arrows to the table directing student from their current station to the next one. Result… with limited navigational assistance from me they found their way around. The same confusion reigned supreme in my attempts to explain the collection requirements: 50 specimens representing at least 13 different orders and 25 different families. All specimens appropriately mounted, labeled and identified to order. Eventual solution…. In this case a sample collection for them to see and a checklist for them to fill in for their own collection finally clarified my meaning to most students.

5. Other bugs are OK.
While beetles will always be the coolest insects out there some of these other bugs aren’t bad. I especially enjoyed learning to identify all the hymenoptera and the amazing number of heteropteran families that I never even knew existed. I am also really glad that I had a chance to learn about the higher groupings within insects and arthropods. I had read some of this literature but always in a fairly casual manner. It was nice to have an impetus to actually dig into this and get a good understanding of the current theories and questions.

Well hopefully I will be able to apply a few of these lessons and do a better job when I teach some time next year. If you were one of my students this semester or last first thank you and secondly.... I hope it was more or less enjoyable :-)

Pinning insects on YouTube

2011-04-02T16:41:00.004-05:00

I told my class that I would make a video that reviewed the proper way to pin insects. Well it could use a lot of improvement but here it is!

Photos for Lectures

2011-04-01T15:55:00.004-05:00

I am slowly trying to put together a collection of photos that are appropriate for the lectures and talks that I have to give for my classes and research. Because of this I need a lot of general beetle photos showing different anatomical structures. Here are a few that I have taken in the last few days. Have a great weekend!

phyloseminar.org

2011-03-30T12:01:00.002-05:00

This is a great website organized by Frederick “Erik” Matsen. The purpose of the website is to be a forum for seminars on phylogenetics via video conferencing. Erick has already had a number of great presenters. Most recently the site has hosted presentations by Luke Harmon and Joe Felsenstein. You can attend these seminars virtually and ask questions in real time or you can simply watch a recording of any of the seminars that have been given thus far. If you go to the site today (11:00 PST) you can attend a seminar being given by Brian O'Meara his talk is titled "Making comparative methods as easy as ABC". Brian O'Meara is an assistant professor at U of Tennessee, Knoxville, in the department of Ecology & Evolutionary Biology. He is the author of the program Brownie and is sure to give an informative and interesting talk.

The Paradox of Variation and Genetic Draft

2011-03-19T14:34:00.002-05:00

I am going to depart from Coleoptera today to talk a little about genetics. I am taking a molecular evolution class this semester and I am in a lab and department that has a lot of interest in population genetics. Recently we have been discussing Lewontin’s paradox of variation and Gillespie’s genetic draft theory. These are really interesting ideas and I felt they warranted a post.

In 1974 Richard Lewontin’s book The Genetic Basis of Evolutionary Change pointed out the “Paradox of Variation.” Put simply this paradox is the observation that genetic diversity seems to be limited to a small range and is not responsive to actual population sizes in the way that we originally assumed it would be.

Mutations can be deleterious, advantageous or effectively neutral. It was believed that for most purposes we could ignore the deleterious and advantageous since the first would be quickly purged from the population and the latter would be exceedingly rare. Assuming for a moment that this is true, we will say that mutations occur at some frequency (µ) and that when a mutation occurs its probability of fixing is equal to 1/2N. This gives us the ability to predict the heterozygosity in the population with the formula H =4Nµ /4Nµ +1.

This theoretical understanding was achieved in advance of our ability to accurately measure heterozygosity. The advent of electrophoretic examination of allozymes allowed us to get our first real glimpse of the heterozygosity of different organisms. In 1974 heterozygosity measurements ranged from .056 to .185. This equated to Nµ values between .01483 and .0567. This variation would mean that population sizes range across less than a fourfold difference. Lewontin and others were certain that this could not be the case. So were had we gone wrong? Obviously some part of our understanding of the spectrum and behavior of mutations was incorrect. Continued research broadened the range of observed heterozygosity however the data still did not agree with our theoretical predictions.

One clue to the possible answer is that heterozygosity of mtDNA shows no sensitivity to population size. What is one of the key differences in mtDNA and nuclear DNA? Recombination. So how is a lack of recombination nullifying the influence of population size on heterozygosity? The answer might be hitch-hiking. Hitch-hiking is the phenomenon where the physical proximity of two loci causes the fate of one to be driven by the other.

John Gillespie tackled this idea with his theory of genetic draft. Gillespie’s idea is basically that occasionally a beneficial mutation will occur and all of the alleles that are physically found on the same chromosome (linked) as the one with the advantageous mutation will be selected and driven to fixation with the one advantageous mutation. Remember the standard formula incorporating only genetic drift is H =4Nµ /4Nµ +1. Gillespie expands this model to allow for hitch-hiking or genetic draft. Heterozygosity would now be equal to 4Nu / (1+2NpE{y²}+4Nu). The middle term 2NpE{y²} is the new term that we need to understand. The term E{y²} is the average frequency of the hitch-hiking allele after a selective sweep. To simplify we will assume that the two sites of interest are tightly linked and that this term can be treated as equal to 1. This leaves us with p… this is the rate of substitutions of advantageous mutations. This is also the most contentious part of Gillespie’s theory. For the theory of genetic draft to explain the observed data p must be independent of N. However, intuitively we would expect p to increase as the population increases.

I’m not sure that I really understand all the implications of genetic draft. So I will continue this post once I have finished reading and digesting this stuff.

To be continued

Scarab Course

2011-03-05T07:43:00.004-06:00

One of the benefits of graduate school is having the time and resources available to take short intensive workshops or seminars during breaks between semesters. Since I started graduate school this last fall I have been looking for any that would interest me. Nothing that I had found seemed all that amazing so far. A couple of pretty good phylogentic and population genetics courses but nothing terribly exciting….. Until I received this email from the Entomo-L mailing list:
A scarab beetle classification/identification minicourse will be held in Chanchamayo, Peru in January of 2012 at a great, mid-elevation location on the eastern slope of the Andes. The course is co-organized by Lic. Biol. Frank Azorsa Salazar (Centro de Ecología y Biodiversidad, CEBIO, Lima, PERU) and Dr. Brett C. Ratcliffe (Division of Entomology, University of Nebraska, Lincoln, NE, USA).

For course info, instructors, costs, etc. see: http://scarabcourse.cebioperu.org/index.html

10 days in Peru focused on scarab beetles!

If the location and that Dr. Ratcliffe is behind it didn’t sell me then check out the list of other instructors: Drs. Ronald Cave, Andrew Smith, Federico Ocampo, Mary Jameson, and Paul Skelley.

Price for the whole thing (airfare, tuition, misc.) will run around $3,000. Now if I can just get a spot! They say that space is limited to 25 students. I have no idea how many people will want to go, but my application will be there well before the deadline of September 1.

Entomology 101

2011-01-28T08:22:00.003-06:00

My university doesn't offer entomology every semester so when I saw it on the schedule I was excited. I went to the assistant chair and the professor for the lecture and got them to let me TA the lab. What could be better than to TA a course that deals with my own personal passion? Its a pretty straightforward intro entomology lab. We are going to cover each of the insect orders as well as a few other arthropod classes. I will teach the students the important characteristics of each group and make sure that they can key them to order or family. I will also cover collecting and curation techniques in general and the special methods needed for some groups. The collecting techniques will be taught mainly through a few field trips in the local area were we will set up malaise nets, FITs, pitfall traps, etc. The students will earn their grade with two practicals and an insect collection that is due at the end of the course.

So the first week is done and I realize that I didn't consider a few things about this course. My worst estimation was the prep time I would need for each lab. I want this to be an amazing entomology lab.... that takes a lot of time. The professor has given me a list of the orders that he wants me to cover but that is about it. This means that I have to come up with the best way to present each group and distill the most important things that my students need to know about them. I also have to find the most appropriate example of each group for keying so the students get to see variety but not too much so the important similarities are still obvious. Figuring all of that out while I work on writing papers and studying for my own courses is a challenge.. but a fun one.

In my next lab I am going to cover non-insect arthropods. Part of this will be teaching the students the basics of deep arthropod phylogeny (something I don't follow closely) which appears to be a bit of a mess. I have found a number of conflicting ideas all published within the last couple of years. Once I figure out what I think about these different takes on the data maybe I will do a post for the blog.

Graduate School: One Semester Down

2010-12-23T11:50:00.005-06:00

So my first semester of grad school is over and I have a 4.0! I had a 3.92 when I graduated from Oregon State so I expected to do well, but it is a relief to have the first semester done and know that I haven't taken on more than I can handle. This first semester I took advanced genetics, population genetics, and a seminar on adaptation. I think that all of the classes will prove to be useful in my work. The advanced genetics course was probably the most important because it brought my base level of knowledge in genetics up to par. Population genetics was an interesting course and I now have several population genetics projects that I would like to pursue at some point. A couple of these should make for good little side projects over the next couple of years as I work on my dissertation project.

In the spring term I am taking a molecular evolution course, scientific writing course and an ecological genomics seminar. In addition, I will be submitting my first manuscript and I am in the process of planning a field project for this summer. I am hoping that I will get a couple of grants that will allow me to spend a month or so in the southwest at the end of the summer.

I think that grad school is the best thing that has ever happened to me. Being able to devote several hours a day to researching, studying, and teaching evolution, Coleoptera, and biology in general is a real treat!!

Happy Holidays

Focus Stacking

2010-11-28T15:35:00.008-06:00

Blogger.com continues to thwart my attempts at putting larger pictures in my post so if you would like to see what the pictures actually look like just click on them.... (sorry)

I am nearing the end of my first semester in grad school so things have been a bit busy. However, I took a break from studying and writing papers to work on the blog at least a little. As promised I found and used a focus stacking software to produce some better pictures of Amphicrossus ciliatus and a couple of other cool beetles. A quick search of the blogosphere turned up some pretty high praise for a program called CombineZP. This is my favorite kind of program... its FREE! This software has a very simple interface but it does a great job of stacking photos and again it is FREE! The software really is amazingly easy to use. To produce these pictures I set my specimen up and focused at the very highest point and took a photograph. I then just turned the fine focus knob 1/4 turn and took another photograph until I had the lowest point on the specimen in focus. Next just batch load these into CombineZP and choose your method from the drop down menu. (I picked "All Methods") The program then putters away on your images for a minute or two eventually spitting out a finished product that you can save.

I decided to play a little more and produced the picture below of a tiger beetle. I have included small versions of each of the photos that were combined to create the stacked photo just so you can get an idea of how this works.

This will be my last post for a week or two. I have to finish up some presentations and projects so wish me luck!

Cool Nitidulidae

2010-11-21T21:55:00.003-06:00

Amphicrossus ciliatus

I do not have the equipment or skills to take macro photos the way that so many of the nature bloggers do. However, the lab that I am in has a great microscope with a camera hooked up to it. So I have started experimenting with it and teaching myself how to use it. I haven't gotten a stacked image to work the way that it should but this beetle was too cool not to share.

When you look at him with a loop it looks like he has two little hard spikes on his elytra however under greater magnification you can see that it is actually a bundle of hairs. I can think of a lot of explanations for this morphology but I have not observed them alive so who knows. I am going to try and get a good stacked photo uploaded later this week until then cheers

An Inordinate Fondness #10

2010-11-18T07:41:00.010-06:00

I'd like to thank Ted MacRae at Beetles in the Bush for letting me host this months issue of an Inordinate Fondness. His blog was one of the first that I began reading and it encouraged me to set up my own. I hope everyone enjoys this months collection of posts!

The Backyard Arthropod Project

Tim brings us what has to be one of the coolest blog post that I have seen in some time. I don't want to spoil the surprise, so I am not going to tell you what he found. I will simply say that this post shows you that you can make some pretty cool discoveries if you are a detailed and careful observer.

6LEGS2MANY

Alison at 6LEGS2MANY gives us a great introduction to Scarabaeidae dung beetles. Her post has a bit of dung beetle lore as well as some nice photos from Welder Wildlife Refuge in South Texas.

Arizona: Beetles Bugs Birds and more

Margarethe at Arizona: Beetles Bugs Birds has a great post focusing on the Mesquite Twig Girdler. This beetle (Oncideres rhodosticta) has been found in huge numbers for the last several years through out the southwest. Her post explains some of the reasons for these mass occurrences.

Biodiversity in Focus Blog #1

Morgan Jackson has outdone himself with his entomological Jack-O-Lantern creations. Apparently this is a lab activity and their amazing creations included Diptera, Hymenoptera and Coleoptera. My favorite is of course the scarab beetle picture above.

Biodiversity in Focus Blog #2

Morgan Jackson also brings us a great guest blog by Adam Brunke. Adam is a graduate student at the University of Guelph and is studying Staphylinidae (rove beetles). Adam is especially interested in introduced rove beetles and explains some of his current research interests and the importance of this huge family of beetles.

Fall to Climb

TGIQ at the blog Fall to Climb has posted some beautiful pictures of a leaf beetle this month. When you go to the blog make sure that you click on the individual pictures of the Calligrapha vicina. This will open the full size version and they are really amazing works of art.

Nature Closeups

Troy Bartlett at Nature Closeups managed to catch a shot of a fleeting myrmecophilous beetle. How you can get a well focused clear shot of one beetle among thousands of ants is beyond me. Thanks for sharing this great shot with all of us.

MObugs

A great article discussing the American Burying Beetle has been posted at MObugs. It includes a description of the life history and current status of the beetle in the wild, and an account of the authors trip behind the scenes of the Saint Louis Zoo's insectarium were a captive population is being maintained.

Up Close with Nature

I know that I love beetles but even if you didn't I think this beetle could make you stop and take notice. Thanks Kurt for sharing your shots of such an amazing creature with all of us.

Weird Bug Lady

Has moved to Arizona to pursue a PhD in entomology, and has posted some shots of Chrysina gloriosa and a Dynastes granti that were attracted to her light on her first night in Arizona. What a treat! Best of luck on your schooling!

The Sam Wells Bug Page

To read about the small click beetle Lacon rorulenta check out this post. You will also find some nice shots of the red fir grove and the surrounding landscape where the beetle was found.

Crooked Beak Workshop

Delbert La Rue ponders the identity of a beetle in the genus Polyphylla. This group had a number of species lumped in the late 1980s under the name Polyphylla diffracta. He doesn't come to a final decision, but at least he has a literature list so you can explore it more fully if you wish.

Natural History Museum - London

What could be better than a blog by a group of people caring for a collection of over 9,000,000 beetles. This blog is supposed to be a collaborative effort with posts by various curators and researchers describing their research and cool beetle stories. If they stick to the plan it could be a great new beetle blog.

No AIF issue would be complete without a post that featured tiger beetles. For that we go to THE tiger beetle blog Beetles in the Bush.

Beetles in the Bush

Ted gives us a post with some great pictures of an amazing beetle. The beetle Cicindela pulchra is a mixture of metallic reds and blues that are truly awesome. Ted's article as always includes a lot more than just pretty pictures. He also includes descriptions and pictures of the habitat, and larvae burrows.

Submit your blog article to the next edition of An Inordinate Fondness using our carnival submission form. Past posts and future hosts can be found on our blog carnival index page.

An Inordinate Fondness

2010-10-18T11:51:00.004-05:00

The creator of An Inordinate Fondness, Ted MacRae at Beetles in the Bush is hosting AIF this month. He has combed the web and found some great posts on Coleoptera. My favorites for this month are:

1. What's Bugging You: Make sure that you checkout Arthur Evans post this month on Chrysina. Even if you are weird and don't like beetles you have to love these guys. Plus Evans tells a great story giving us his history with these jewels and the history of their discovery.

2. Arizona: Beetles Bugs Birds and more: Margarethe Brummermann's post on the Euphoria species of Arizona will make any beetle collector long for a trip to Arizona. She even includes enough info to point you in the right direction to finding these guys

3. Myrmecos: Alex Wild, anytime he points his camera at a beetle it is worth taking note. This month he took some amazing pictures of Aethina tumida a hive beetle.

Enjoy all the great beetle posts this month!

Waddington and Genetic Assimilation

2010-09-26T09:58:00.008-05:00

Conrad Hal Waddington lived from 1905 to 1975. Today Waddington is largely remembered for his bithorax genetic assimilation experiments. However, he was also one of the first EvoDevo guys. In the 1930s he showed that Hensen's node cells from a blastoderm stage chick embryo when transplanted could cause changes in the organization of the morphology of a rabbit embryo. This confirmed that though in different classes they were using the same “machinery or language” to control morphological development.

Much of Waddington's most important work was done in the 1940-50s. Combining his embryology background with genetics he came up with the idea that morphological development was a series branching choices, and that what choice was made was decided by the genes. The recent discovery of drosophila genes like aristapedia which cause the formation of a bristle or a leg were particularly important in this conception.

This idea of successive binary choices as a cell or tissue develops is his idea of the epigenetic landscape.

Genetic Assimilation is a theory proposed by Waddington which provides a way for traditional Darwinian selection to be the driving force for apparent “pseudoexogenous” adaptations (transmission of acquired traits).

So how did Waddington show genetic assimilation.

First take your fly pupa and expose them to high temperatures, ether, or some other stress and a certain percentage would develop a mutation such as bithorax or no crossveins in the wing. Then breed the ones most strongly effected for your trait of choice (up selection) for several generations. In each of these generations your are exposing them to the same conditions during development. As this proceeds you will find larger and larger portions of the offspring exhibiting the trait. After several generations you could even dispense with the stressor and still you get this trait that was never seen in the absence of stress in the original stock. The question is what is happening here!

Waddington's explanation and diagrams are great. His idea was that as an organism developed it could take any number of developmental pathways almost like an inverted tree or the channels of an alluvial fan. He believed that each of these “choices” in development was controlled by genes. Despite this he also believed that under normal circumstances the wild type developmental pathway (green in the drawing) would be the best one for an organism to follow and that natural selection would select for any mutations that reinforced this developmental pathway and resulting phenotype. Only when an organism was under stress (such as high heat) would these alternate pathways be revealed. By then setting up artificial selection for only those flies that follow another path (blue in this case) you could increase the number of genes found together in the offspring until you reached some point were enough of the various genes were present in the up selected population that the trait would be expressed regardless of environmental conditions.

This explanation is based on the idea that there is a great deal of cryptic genetic variation present in the organism and that this is protected from selection until the animal is under stress when it can suddenly be revealed to natural selection selection. Tying this in with the idea of a fitness landscape the organism is able to go from a tight cluster of one phenotype (red) to being spread over a large number of phenotypes green. This could provide a way for the organism to cross a fitness valley and provide many different type of phenotypes to interact with natural selection in a stressful environment.

This however is not the only explanation for what is going on. Another explanation might be that you are increasing the overall mutation rate and that these new phenotypes are simply products of this... to be continued

Micromalthus debilis

2010-09-22T19:14:00.007-05:00

I believe that part of making great discoveries is picking the right subject to use in your investigation. To this end I have been working to become familiar with many of the odd reproductive strategies and unusual genetic systems within Coleoptera. At the top of a list like that has to come Micromalthus debilis LeConte 1878. This apparently ancient member of the suborder Archostemata has such a complicated and bizarre life history that I felt I should write it up just to make sure that I understand it personally.

First a few definitions to lay the groundwork.

Paedogenetic: Producing young while in the immature or larval state.
Thelytokous parthenogenesis: Producing only females from unfertilized eggs.
Arrhenotokous parthenogenesis: Producing only males from unfertilized eggs.
Amphiterotokous parthenogenesis: (I can't actually find a definition for this word... but it is used...) to describe larva that appear as though they should have produced a male but for some reason have failed to and after a delay begin producing (parthenogenetically) females.
Haploid and Diploid: A diploid organism has two copies of each chromosome while a haploid organism has only one copy of each chromosome.
Ovoviviparous: Refers to animals that produce eggs but retain them inside the female body until hatching occurs, so that "live" young are born. Some of the source papers for this article refer to these beetles reproducing viviparously but I can find no evidence of this in anywhere so I am using this more conservative term.

I created the flowchart below to show all of the different possible developmental pathways. It is amazing to think of the amount of morphological data stored in this genome. These 10 chromosomes are capable of producing so many unique phenotypes. Learning what signals are important in determining the appearance of these phenotypes would be quite interesting.

I found the easiest way to think about this is to start with the triungulin larva. This larva always develops into a cerambycoid larva. From here we can go the simple path of producing pupa and then an adult female, or the alternate option to molt and become a reproductive larva. There are three type of reproductive larva the most common is the thelytokous larva which is responsible for most reproduction in a population. This larva Ovoviviparously gives birth to large numbers (up to 20) triungulin larva. The other two options are to produce a single male curculionid larva that consumes the mother before pupating into the adult male form or if the male does not develop for some reason the larva can after a delay begin producing triungulin larva though not usually in the numbers seen in the thelytokous larva form.

Allan Charles Scott published a paper in 1938 titled Paedogenesis in the Coleoptera were he describes his discovery that the fate of larva are decided very early on. He was able to discern significant differences in the ovaries of cerambycoid larva allowing him to identify those that would pupate into adult females, thelytokous larva or one of the other two classes of reproductive larva. These last two classes of larva can not be told apart until much later and it may be that arrhenotokous larva can develop into amphiterotokous larva under the right conditions. The traits that Scott looked at were the number of lobes in the developing ovary and the size of the egg cells.
On the left we see one ovary of the thelytokous larva, in the middle we have the adult female ovaries, and on the right we have the ovaries of the Arrhenotokous larva. (Figure from Scott, 1938)

Scott's 1938 paper also includes a drawing of all 5 reproductive forms of Micromalthus debilis which I have reproduced and explained below.

Adult Reproductive Forms
D-Adult females: Are diploid and have 20 chromosomes. They can lay eggs that are presumably fertilized by males. These eggs are believed to develop into triungulin larva capable of any of the various developmental paths. Which development path is followed is most likely controlled by the environmental conditions. Whether these females are capable of laying unfertilized eggs that will develop is unclear from the research that I have found. It is also interesting to note that Scott who has done the most thorough examinations of this species found never more than two eggs close to maturity in females (in contrast the Thelytokous larva can produce broods of up 20 larva). This is particularly odd if we assume that this stage is the primary dispersal stage.

G-Adult males: Are haploid organisms and have only 10 chromosomes. These males can presumably fertilize adult females they do definitely produce sperm though meiosis does not progress in the normal fashion (only 2 spermatozoa are produced from each primary spermatocyte.

Paedogenetic Forms Reproducing Parthenogenetically
(These are circled in red in the flowchart)
B-Thelytokous Paedogenetic Female: This form of the beetle is the most prolific. Via parthenogenesis and ovoviviparity it produces broods of the triungulin larvae. Like other triungulin larva in this species they are capable of following any of the developmental pathways.

E-Arrhenotokous Paedogenetic Female: This form matures a number of eggs but only one of these is shed. This egg adheres to the mother after being shed and hatches after a very short time. When it hatches the male curculionoid larva begins devouring the mother immediately. This is the only source for larva that will develop into the haploid male.

C-Amphiterotokous Paedogenetic Female: this form has proven to be essentially a male producer (Arrhenotokous Paedogenetic Female) in which the development of the male is arrested and female-producing eggs develop secondarily.

A-Cerambycoid larva

F-pupa

If there are any obvious or not so obvious mistakes please feel free to let me know.

Source Papers

Pollock, D. and Normark, B. (2002). The life cycle of Micromalthus debilis)(Coleoptera: Archostemata: Micromalthidae): historical review and evolutionary perspective. Journal of Zoological Systematics &# 38; Evolutionary Research 40, 105-112.

Scott, A. (1938). Paedogenesis in the Coleoptera. Zoomorphology 33, 633-653.

I can do this!

2010-09-17T20:07:00.002-05:00

Well I have been in graduate school for about a month now. I was pleasantly surprised by the difficulty of my classes. Prior to starting I had worried that they might be insanely difficult. You know with 100's of pages of reading a night and stuff like that. They are a big step up from undergraduate courses at Oregon State but they are not impossible or anything. I am lucky though UTA completely supports me with assistantship, fellowships, and scholarships so I am able to spend all of my time focusing strictly on science.

A BIG chunk of that support is in the form of my assistantship. Its pretty straight forward I teach two to three lab sections of biology, zoology, or A&P each semester. These labs didn't start until this past Monday. What I didn't tell anybody was that over the last month as I went to my classes and seminars I was secretly terrified of this week. I had never had a job were I had to speak in front of a group of people and I was fairly certain that I would meltdown and be unable to speak when I stood up in front of that first class.

I kept going over and over my options and couldn't see any way out. How was I going to keep going to graduate school if I couldn't keep my assistantship? Why would I keep going to graduate school? After all, spoken communication to your colleagues and students is about as important as anything that we do in academia. If I couldn't find some way to get over this fear I was in big trouble.

Finally the day of my first lab arrived and I was fairly certain that I was heading for disaster as I walked down the hall to the room. To my complete surprise it went well! It took me about 5 minutes to calm down but then everything went fine. I know that I spoke too fast and forgot about ten different things but I don't think any of the students noticed.

I taught two more labs later that week and they were each better than the last. In fact I feel so much better about my ability to talk in front of people that I am looking forward to presenting some papers in my classes and lab meetings. Don't get me wrong I have no desire to go stand at the bottom of an amphitheater and lecture to 300 people, but I think that I can work up to that someday now that I have taken a first step in that direction.

My final thoughts..... Grad school is fun, and I am really lucky!

Best of all I have time to go collecting. I went out and collected tiger beetles this week at a local creek and found

Cicindela trifasciata ascendens

Cicindela ocellata rectilatera

Cicindela duodecimguttata

Tetrach carolina carolina

Finally Starting

2010-08-30T11:13:00.001-05:00

Graduate school is finally starting up, and I really think that I am going to like it at UTA. This first semester I am taking advanced genetics, population genetics, a natural selection seminar, and independent study with my advisor. I have a lot of catching up to do in my understanding of genetics, but the advanced genetics course is really a fast paced review of general genetics so that will certainly help out.

For my independent study I am reviewing a lot of old literature on Coleoptera cytogenetics which is really interesting. It is amazing how diverse the genomes of Coleoptera have become in 250 million years. My genetics professor mentioned that genomes are much more modular and adaptable than we once thought. This is really obvious in my cytogenetics review when you see how often closely related species posses strikingly divergent karyotypes.

My advisor is also passing a lot of interesting speciation genetics books and articles my way. Yesterday I read chapter 19 out of Endless Forms: Species and Speciation. This chapter by William Rice is a look at the different types of evolutionary conflict and the relative importance of interspecific vs intraspecific sources of conflict. Rice thinks that the importance of intergenomic conflict has been underestimated as a source for the genetic divergence that leads to reproductive isolation.

Intergenomic conflict is basically conflict between two members of the same species involving coevolution were one group, say males, evolves an advantage that the females evolve a response to and this continues over and over again.

To support the theory that intergenomic conflict is an important source of evolutionary conflict Rice designed a simple experiment that shows, at a minimum, that there is ample genetic diversity to allow evolution in this area. His experiment used a Drosophila melanogaster line to mimic a hybridogenetic breeding system. In the case of his experiment it was the males that were semiclonal. He bred this population for 30 generations always drawing the females for each generation from a stock population. This allowed the males to evolve without allowing the females to evolve in response. At the end of this process he bred original stock males and the line bred males with the original stock females. Looking at a number of categories (fertilization, number of offspring, remating, etc.) he found that the new males were roughly 20% more successful than the stock males.

I have known for years that many beetles can only be distinguished by examining the genitalia, but I had never really stopped to consider the evolutionary meaning behind this. After reading this though it is easy to imagine that a slight change in the shape of a male genitalia might allow for a better fertilization rate or reduce the likelihood of subsequent males success in remating.

For details on the "clone generator" females that allowed him to mimic a hybridogenetic breeding system read his chapter:

1998 Rice, W. R. Intergenomic conflict, interlocus antagonistic coevolution, and the evolution of reproductive isolation. pp. 261-270 In: Howard, D. J., & Berlocher, S. H. (Eds.) Endless Forms: Species and Speciation. Oxford University Press.

My own personal whirlwind!

2010-07-19T13:06:00.001-05:00

I’m sorry for the total lack of updates. However it has been a truly busy and crazy month. I have moved, got an office, started an interesting project with my professor, and am about to leave town on a cross country family collecting/road trip.

The house that I moved into is great. The university owns it and I can see the biology building from the front porch. It has 3 bedrooms, 2 bathrooms, a 2 car garage, and a great big deck and backyard. It’s really nice and gives the kids tons of room to run around and explore. The down side was that it had been vacant since winter time and the back yard had not been cared for in years. The first few days I spent 8 hours a day just uncovering the backyard from the layers of bushes and branches that had overgrown the entire place. However, it is at least usable now and we should be able to put in a nice vegetable garden next year.

My office is small, shared with another grad student, and old. However, it is MY office, and I get to use it for studying beetles and genetics and other cool things! So even though it is small and yucky, it is the first time in my life that I am being given an office for the express purpose of studying biology. That seemingly small distinction makes all the difference in the world, and because of that it is the best office I have ever seen!

While doing all of that I have also been planning for a big collecting/roadtrip. My family and I set out this Friday to head to Michigan. We are going to hit some of the major touristy stuff that my wife and daughter want to do as well as collect beetles and fossils along the way. Eventually we will get to Lake Ann Michigan were we will spend a few days with some good friends before heading back.

View Trip To Matt's in a larger map
I will post some photos of the new place soon!

Taxacom

2010-06-08T23:26:00.005-05:00

For the past few months I have subscribed to the Taxacom email list. I have tried a number of listservs over the years and I have usually regretted it fairly quickly. Most listservs seem to be plagued by off topic posts and flames that take over and waist everyones time. However, I have been pleasantly surprised with Taxacom.

While there are certainly people who have an ax to grind on particular topics, the discourse is as a whole civil and intelligent. As a student, this has been a great learning tool for me. I have been able to sit on the sideline and observe as professors from great universities and directors of important collections from around the world debate issues such as: the definition of a species, phylocode, open source publishing, and many other topics.

If you would like to search the archives of Taxacom or join the mailing list just go to their web page.

E.O. Wilson

2010-06-04T00:42:00.003-05:00

This is a great video that provides a one hour overview of some of the many amazing activities and scientific contribution of Dr. Wilson.

Evolution and Religion

2010-06-03T21:27:00.005-05:00

Today I read an article I find quite difficult to digest. The author Michael Reiss is an English bioethicist, anglican priest, and educator. His article in Evolution deals with the relationship between evolutionary biology and religion in an educational setting.

Just to be clear on my own beliefs, I don't know if there is a god or not. If I stop to think about it my guess is yes something probably created the conditions for a universe to form. I don't pretend to know anything more than this and I have not yet run across anything that made me think there must be an involved or active god.

In the first part of his article he attempts to define the "nature" of science. He puts forth the idea that the subject matter of science is limited and that some questions such as: the origin of the universe, nature of love, nuclear vs wind power, etc. should be in the domain of religion, philosophy, or economics. He sums this up with the statement:

"Science is concerned with how things are rather than with how they should be. So there is a science of gunpowder and in vitro fertilization without science telling us whether warfare and test tube births are good or bad."

So I can't discount this... but I also find it hard to accept. I think the reason I find this so difficult is that I am basically an agnostic secular humanist and look to "science" for not only the how things are but also the how things should be. I also don't see how we benefit by dividing the world of ideas into domains to be tackled by different systems of knowledge (natural science, religion, philosophy.) Someone like myself is still going to come to loggerheads with a literalistic Christian who believes in a young earth.

Reiss goes on to discuss his view of the "nature of religion" and then finally gets to the heart of the article that discusses creationism and evolutionary biology in a class setting. This is also the part of the article I simply find unacceptable. He says:

"Creationism can profitably be seen not as a simple misconception that careful science teaching can correct. Rather, a student who believes in creationism can be seen as inhabiting a nonscientific worldview, which is a very different way of seeing the world. One rarely changes one's worldview as a result of formal teaching however well one is taught. My hope, rather, is simply to enable students to understand the scientific worldview with respect to origins, not necessarily to accept it."

To me this is just giving up. Simply because it is hard to change someones mind or to convince someone of the fallacy of long held beliefs does not mean that educators should simply accept errant beliefs in students grasps of a subject. If we were discussing another subject we would not accept this would we? If someone came up with an alternate math system based on religious texts that was disprovable with standard math would we still accept belief in this alternate math after taking an algebra class. I don't think that we would. I think that we would require that our students understand and accept the realities of math as we understand them today.

Despite my negative views of creationism and most especially "intelligent design", I feel that there is room for religion in our understanding of the world. However, I think that it is intuitively obvious that it should be relegated to addressing those questions that science has yet to provide germane answers for.

Reiss, M.J. 2009. The Relationship between Evolutionary Biology and Religion. Evolution 63 (7), 1934-1941

http://www.bioone.org/doi/abs/10.1111/j.1558-5646.2009.00714.x

C. splendida and or C. limbalis

2010-06-03T19:01:00.004-05:00

Like most coleopterists I have a soft spot for tiger beetles. These beetles have it all: beauty, interesting behavior, convenient size, and they even give us an excuse for going to the beach. So when I saw an article by Barry Knisley (tiger beetle guru) I was immediately interested.

The article discusses a genetic study of the difficult to diagnose pair Cicindela splendida and C. limbalis. These two species are sympatric in fairly large regions and have been considered valid species that can be separated based on coloration, maculations or setae. Previous studies have even discussed possible paleogeographic history that could have led to the allopatric speciation of these two species.

However, the study done by Woodcock and Knisley shows that we should perhaps look a little closer at these two species as well as C. denverensis. It ends up that when analyzing the mtDNA specifically cob and cox1 these 3 species all sort out as a single assemblage. Furthermore the authors could find no genetic correlation with the geographic source of the specimens. The fact that these species could not be reliably sorted via mtDNA does not by itself prove that these are not valid species; it does though tell us that if they are unique species they have diverged very recently.

This paper shows you just how much work is left to be done with Coleoptera. This is a group of beetles that are as popular as any and yet we still have so much to learn and figure out. Very exciting stuff!

Woodcock, R. M., C. Knisley. 2009. Genetic Analysis of an Unusual Population of the Problematic Tiger Beetle Group, Cicindela splendida / C. limbalis, from Virginia U.S.A. (Coleoptera: Cicindela) using mtDNA. Entomological News 120(4):341-347

http://www.bioone.org/doi/abs/10.3157/021.120.0401

Programming 101

2010-05-31T16:50:00.006-05:00

One of my many goals for this summer is to get a basic understanding of computer programming. I don't know how far I will pursue this, but I want to be a able to write simple straight forward programs. I chose Python since it seems to be a straightforward language and should serve as a suitable introduction if nothing else.

I purchased the book Python by Toby Donaldson. I have made it through the first few chapters that cover the basic ideas of: types of variables, input, output, basic math function, loops, and logic. This book has worked well as an introduction to the basics of computer programming. Unfortunately, none of the samples and exercises are remotely related to biology. I decided that I should try to write a functioning program with a biology slant. A program that could calculate the percentage of different bases in a nucleotide sequence seemed like something that I should be able to tackle so:

After some experimenting I came up with the following code.

DNA=input('paste your nucleotide sequence here: ')
a=int(DNA.count('A'))
t=int (DNA.count ('T'))
c=int (DNA.count ('C'))
g=int (DNA.count ('G'))
print ('')
print ('Number of bases evaluated = ' + str(a+t+c+g))
print ('')
print ('Adenine = ' + str(round((100*a/(a+t+c+g)),2)) + '%')
print ('Thyamine = ' + str(round((100*t/(a+t+c+g)),2)) + '%')
print ('Cytosine = ' + str(round((100*c/(a+t+c+g)),2)) + '%')
print ('Guanine = ' + str(round((100*g/(a+t+c+g)),2)) + '%')
print ('')
print ('Purines = ' + str(round((100*(a+g)/(a+t+c+g)),2)) + '%')
print ('Pyrimidines = ' + str(round((100*(t+c)/(a+t+c+g)),2)) + '%')

I tried running this a few times by just typing in 20 or 30 random bases and it worked great. So I went to Blast and got a 900,000 bp chunk of chromosome LG3 of Tribolium castaneum. I dropped this in at the prompt and in no more than a second I was rewarded with:

Number of bases evaluated = 906028

Adenine = 35.05%
Thyamine = 34.72%
Cytosine = 14.97%
Guanine = 15.24%

Purines = 50.30%
Pyrimidines = 49.69%

I know that this is a super simplistic program, but I think it is a cool start with just a few days of getting into this whole effort.

Super Packable Light Trap

2010-05-22T12:20:00.006-05:00

Since my DIY malaise net worked out well I decided to try and build some inexpensive portable light traps. I wanted to have something that I could easily carry several of and set up in one general area. Each one could run off of a battery and I could heavily sample an area in just a couple of nights.

Simple and cheap equipment list:
Heavy 10 mil clear plastic drop cloth
Four 3/16 wooden dowels
1 roll of duct tape
1 gallon jar
Nylon twine

The trap is super simple. It is made out of three pieces that are then connected together. All of the parts are held together with duct tape.

1) The top is a 2.5'x2.5' square. It has a small hole in the center for the twine that will hang the trap.

2)The second piece is the funnel at the bottom. To keep things simple this is a four sided pyramid with the apex cut open and taped into the lid of a gallon jar.

3) The final piece is the baffles. The baffles are were I placed the dowels and the other two pieces are connected to the baffles. The string to hang the trap attaches to the light and the top of the baffles. The way that I attached everything the trap does not have to carry the weight of the light.

When I set up the trap I hung it from a tree just high enough to keep the plastic taught (the collecting jar was still on the ground).

I was very happy with my test run of the trap. It stayed up all night despite some light sprinkles and a bit of wind. The baffles which are much wider and taller than a traditional light trap seemed to work well bringing in a plethora of little staphs, carabids, and no doubt many other interesting things.

I'm Done!

2010-05-22T00:00:00.005-05:00

Sorry for the hiatus but I had to focus on finishing a couple of final requirements for my undergrad degree.

As of today I have officially fulfilled all of the requirements for a B.S. with a major in environmental science and a minor in fisheries and wildlife biology. HOORAY!

Over the past couple of weeks I have also been experimenting with reference management software. I have a collection of about 500 articles dealing with Coleoptera and different aspects of evolutionary biology. My goal was to find a free and effective program that would allow me to search, organize, and access these articles. Currently I have them roughly sorted into approximately fifteen folders but this system is limited to single categories for each article and wont allow me to search by keywords or authors easily.

The three programs that I looked at the most were CiteULike, Zotero, and Mendeley. Deciding which of these was worth the time that it would take to initially migrate my files to was difficult, but eventually I decided that the best choice was Mendeley. Mendeley offered the advantage of pdf renaming based on article info and some social network tools that can help me to discover new articles. Furthermore, it offered a fairly easy interface to add bibliographic metadata to the many files that were missing this.

The last thing that brought me over to the Mendeley side was the ability to set up shared collections on their web site. My understanding when I began the process was that I would be able to make a collection of papers available to anyone that wanted to use it online. However, apparently the owners or creators of Mendeley are insuring that they don't get into copyright trouble because when you create a public shared collection the files themselves are not available to others. I understand the reasoning but I find it incredibly lame. All of my files were obtained legally if a fellow researcher wants to read it I think that I should be able to allow them access to it simple and easy.

Even with this one downfall I think that Mendeley is still a fairly nice program. My files are at least now named intelligently for the most part. The process of manually finding and entering all of that bibliographic data should pay off even if I move to a new program in the future since it is stored as metadata within the pdf.

I should be back to regular posts now that things have settled a bit. Tomorrow I will try to post a story and pictures of a new light trap that I built for an upcoming trip.

http://www.mendeley.com/
http://www.zotero.org/
http://www.citeulike.org/

Reading List?

2010-04-20T00:26:00.003-05:00

In a couple of weeks I will be finished with my undergraduate work. Hooray!!! I will finally have a few months to read anything that I choose. My first thought was Asimov, Niven, and Card. However, I quickly came to my senses and decided that I need to prepare for graduate school. So, help me out and tell me which books or papers have influenced your career and research the most. What books do you think every biologist should have on their shelf. Help me build my summer reading list. Thanks.

Drosophila melanogaster vs. Sophophora melanogaster

2010-04-16T00:55:00.006-05:00

Tonight I am going to digress from beetles and talk about the Drosophila debate.

On April 8th Ellinor Michel sent a message to the Taxacom listserv which announced that the ICZN had decided not to protect the combination D. melanogaster. This short message has created a great discussion on the mailing list with a variety of viewpoints being discussed in a largely cordial manner.

First for a little background:

The genus Drosophila was erected in 1823 by a Swedish botanist and entomologist Carl Fallén for the species D. funebris. Seven years later Johann Meigen a German entomologist described melanogaster and placed it in the genus Drosophila. Personally I believe that this clear taxonomic history is the strongest and most important argument for not preserving the combination D. melanogaster.

Unfortunately the traits that were originally used to define Drosophila were far too broad and

have led to its role as something of a taxonomic dumping ground. Even after the removal of the Hawaiian “fruit flies” to the genus Idiomyia, Drosophila is still a highly variable genus with more than a 1,000 species. Furthermore taxonomic work over the last two decades have made it clear that the genus is home to a number of clades that CAN be clearly defined both by detailed studies of morphology and molecular analysis. The taxonomic problem arises when we compare these clades within the genus Drosophila with other genera. It turns out that some of these clades are more closely related to other genera than they are to the clades in their own genus. This is then very clearly a paraphyletic genus.

The discussion that has been going on in the listserv can be divided into a few primary threads.

1) Should the ICZN have been petitioned? / Was the petition asking the right question?

Here I would have to agree with those who say no in both cases. The reasoning is that this is a question of phylogeny first and foremost. The ICZN's realm is limited to nomenclature not as a court for phylogeny debates. Perhaps the best course of action would be for all interested scientists to publish their respective phylogenetic analyses and then we can let the cards fall were they may. If we are truly concerned about maintaining the name of D. melanogaster then it would seem that a petition to the ICZN to designate it as the type species for the genus would be most appropriate. (IMHO it should not be conserved let the geneticists, supply houses, and others accept it or not, but if it needs to be renamed rename it!)

2) Is a paraphyletic genus a problem?

Yes and No. In principle there is no excuse for a paraphyletic taxa. Hennig's development of phylogenetic systematics is to this day one the most important advances in the way that we study and organize the life on our planet. To step away from the principle of monophyletic taxa is just a step backwards in general. Some would argue that when a group is highly known and clearly defined, such as the class Reptilia, that it is acceptable even though it is clearly paraphyletic. Still others would say that the survival of ancestral species that have given rise to multiple well defined radiations are a reason to accept paraphyletic taxa. I have yet to find an explanation of paraphyletic taxa that I find convincing.

3) Will people adopt a new name?

Maybe they will, maybe they won't. This question is a great topic of discussion and even a mission for someone inclined to persuade others. I don't believe though that this is a topic that should be of concern when determining what should be done taxonomically.

4) Will a new name make retrieving data more difficult?

This is a valid question and in all honesty changing the name will most likely make retrieving data on the species in question slightly more difficult. However, this is not an insurmountable problem and there is no reason to think that any data will be unaccessible once the name is changed. The fact that D. melanogaster is so very ubiquitous virtually insures that even those just beginning their scientific careers will be well aware of its original name for decades to come.

5) Is there an alternative solution?

Yes! Simply lift genera out of Drosophila. This is what was done with the Hawaiian fruit flies and could be done with any of the other clades in question. By going down this road we could eventually end up with a Drosophila genus that is home to the sub-genus Sophophora and the D. funebris group.

These thoughts are my own opinions after reading all 70+ emails. If you disagree with the conclusions that I have drawn I would love to hear why. I am new to the whole taxonomy thing and know that I have a lot to learn.

A few links that I used:
http://iczn.org/content/drosophila-melanogaster-opinion-issued-case-3407
http://www.cladistics.org/about/hennig.html
http://heathenscientist.blogspot.com/
http://taxacom.markmail.org

Dung Connoisseurs

2010-04-12T21:08:00.005-05:00

Today my literature searches led me to an unusual paper titled: Influence of carrion smell and rebaiting time on the efficiency of pitfall traps to dung beetle sampling. This title immediately struck me as humorous. I mean we are seriously investigating whether beetles that are drawn to the odor of pig feces are offended by the smell of a few dead insects.

I was skimming over the article until I reached the results and was forced to slow down. To my utter surprise it ends up that these dung loving beetles ARE offended by the smell of their decaying counterparts. Well my assumption then was that the authors must be talking about some small group of species that are only attracted to very fresh dung. Well I was wrong again. The authors recorded over 20 species in 13 genera most of which showed a preference for traps which were cleaned out daily. The authors actual data are shown to the right.

I added this article to my personal library because it reminds me that what may seem like a reasonable assumption often is not and should be tested by well designed research.

Flechtmannn, C.A.H., V.G. Tabet, I. Quintero (2009) Influence of carrion smell and rebaiting time on the efficiency of pitfall traps to dung beetle sampling. Entomologia Experimentalis et Applicata 132:211-217

Graduate School Decision Time

2010-04-08T22:46:00.004-05:00

I have been very fortunate in the graduate school application process. I got great offers from both my first and second choice schools. Oregon State University was my first choice and my second choice was the University of Texas at Arlington.

I applied to OSU primarily because they had hired THE beetle phylogeny guy, Dr. David Maddison. I had read articles and watched lectures by him and as an amateur coleopterist the idea of being able to learn beetle systematics from him was simply awesome.

(Plus, there are a lot of interesting beetles that only occur out west and living there for a few years would certainly help my collection!)

On the other hand, I applied to UTA because it was close to home and I thought that it would be a good “safety net” school. UTA was also attractive because they have BS to PhD program that I should be able to complete in five years.

To my delight I ended up getting to interview with both schools. Dr. Maddison emailed me to set up a video Skype interview. This was both great and TERRIFYING. I was about 20% sure that his first question would be what the heck was I thinking when I applied. To my relief he was quite down to earth and we had an enjoyable discussion about both of our entomological interests. Dr. Maddison and the curator of the OSU collection Dr. Marshall were both really great guys. I eventually had a number of conversations that sorted out what would be involved in earning a masters degree at OSU with these two great coleopterists as co-chairs.

At the same time Dr. Jeff Demuth at UTA called me and invited me to come out and spend a day with him and the members of his lab. I decided that this would be a great idea since there was a real possibility that I might end up at this school. Dr. Demuth's research focuses on evolutionary genetics, and he uses Tribolium and Gnathocerus species as model organisms in his lab. UTA has made a major push to become a center of genomic research, and as such has put together quite a genomic research facility including a 454 sequencer.

Eventually OSU offered me a position as a research assistant in the collection doing curatorial work while I pursue a master's degree focusing on a revision of Pacific NW beetle group. This type of offer from OSU was a real dream come true. Meanwhile UTA offered me a graduate teaching assistantship which will transition to a RA position. This was supplemented with a couple of grants and fellowships. The topic of my study at UTA is a bit more open with a couple of professors expressing a willingness to take me on despite my current lack of a clearly defined topic.

I never dreamed how hard a decision this would be. After a great deal of stressful consideration I chose UTA. The reality of the situation is that I am an older student and I am married and have two kids. UTA was able to offer a much better financial package, and I can stay close to home were my extended family can help me with the kids. Furthermore, I believe that I will be able to make my degree my own at UTA. I believe that with the guidance of Dr. Demuth and the other faculty at UTA I can become a biologist with the skills and knowledge to help us understand Coleoptera better than we do today.

This humble attempt at a blog will hopefully document my search for a niche in the Coleoptera community and my growth into a biologist that I can be proud of. I have to say that in both the graduate school application process and in these first couple of weeks of blogging I have been pleasantly surprised with the welcoming nature of all of the people that I have met.

A history of coleopterology

2010-04-07T00:13:00.008-05:00

In my ongoing Coleoptera literature review I ran across an article by Rolf Beutel titled “Charles Darwin, beetles and phylogenetics.” I figured that any article that can be described by that collection of words can't be all that bad. Reading the article I found that it was a great review of the history and current trends in the study of the best bugs on the planet.

The first part of the article recounts Darwin's beetle exploits, contributions, and references. Including my personal favorite story of when he placed a bombardier beetle in his mouth. The authors are quite thorough and discuss both Darwin's prescient ideas about the way that phylogenetic theories should be supported and the instances were he missed the mark discussing dung beetles and the idea that traits might be inherited mutilations. This portion of the article is only a couple of pages long, but it is an enjoyable reminder of the role that Coleoptera played in Darwin's studies.

The rest of the article takes us through the modernization of the study of Coleoptera. For a launching point the authors begin with Schiodte who performed some of the first detailed studies of beetle larval morphology. Despite this type of detailed morphological study beetle taxonomy in the 1800s suffered from inherent weaknesses thanks to the idea of linear progression (the idea that a phylogenetic tree should reflect “less evolved” species at its base and “highly evolved” species at its apex).

The authors go on to describe the major players that moved Coleoptera classification forward through comparative studies of wing folding, male genitalia, and other important traits. This brings us up to the 1950s when we get Hennig's crucial “Phylogenetic Systematics.” The importance of Hennig's work is hard to underestimate. The move to a focus on synapomorphies rather than general similarity was one of the changes that has helped us to see the true phylogeny of beetles and all living things.

Next we get a run down of the amazingly broad contributions of Crowson and Hinton. Followed by a brief discussion of the contributions that the study of fossilized Coleoptera have produced and some explanations for its apparent failures. After the paleontology is dealt with we finally reach the molecular age.

The authors spend four and a half pages discussing the journey from the earliest small molecular studies performed by Vogler all the way up to the plans and status of the ambitious BToL project. This is a large collaborative project that will collect DNA sequences and morphological data from many hundreds of species. This data will be used to generate robust and well supported theories for the overall phylogeny of Coleoptera and hopefully for specious and complex groups like Polyphaga.

One thing that became quite clear by the end of this article is just how lucky I am to be studying coleoptera at this time in history. The work by all of the great coleopterists of the past has provided a firm classification within which there is still a tremendous amount of work to be done. I can't imagine the feeling that the very early coleopterists must have had when so few taxa were well defined.

This is a great article for someone like myself who is just about to start a graduate program. By the time I was done reading it I was excited and had a list of new articles to read. I recommend this paper to anyone that needs to get a good feel for the history and current status of Coleoptera taxonomy.

R.G. Beutel, F. Friedrich, and R Leschen (2009) Charles Darwin, beetles and phylogenetics. Naturwissenschaften 96:1293–1312

As Ted MacRae points out in the first comment this article also features a beautiful phylogenetic tree originally produced by Haeckel in 1874. Its amazing to see some of the artistic talent in older scientific works.

DIY Malaise Net for $69.00

2010-04-03T17:13:00.008-05:00

I have a limited beetle collecting budget, and I could never justify spending several hundred dollars on a device like a malaise net. However, I was about to build a couple of flight intercept traps (FITs) and decided that the additional work required to make a combined malaise net / FIT was well worth it.

Step 1 – Supplies: I was able to buy all of my supplies and equipment at the local DIY store.

1 roll no-see-um screen material 48”x25’ (I used this for most of the trap)
1 roll fiberglass mosquito screen material 48”25’
100’ 3/16 synthetic braided rope
1 funnel
1 gallon jar (free from a restaurant)

Grand total for all of this $69.00 and I have enough screen left over for a couple of traditional FIT traps.

Step 2 – Planning: I made a rough drawing of my intentions to guide in the cutting process. I made the whole trap quite a bit taller than a normal malaise net since I am going to use it as an FIT as well.

Step 3 – Sewing: I began assembling the trap by sewing two panels together forming the main interception panel of the trap. Next I attached the two end panel pieces. Finally with a bit of difficulty I sewed on the roof of the trap.

Step 4 – The Container: For my collection head I wanted to use a liquid preservative. After looking at some professional traps for ideas, I decided that I would attach a funnel at the peak of the trap that could then enter a hole in the side of my jar. This works by having a rope attached to the funnel that goes through the opposite side of the jar and then up to a tree or other support.

Step 5 – More Sewing: Next I attached the ropes. Long ropes at both ends and shorter ones on the sides and finally little loops for stakes along the bottom.

Step 6 – Testing: So how did it work? I set the trap up in wooded area for a couple of hours just to make sure that it would work.. It seemed to function quite well. In an hour I had probably collected 60 or 70 wasps and dipterans.

Step 7 – Using It: My daughter and I are going to take a collecting trip up to Oklahoma and Arkansas in a few weeks. We will set it out for several days in one spot and see how it functions over an extended period then. I'll post some pictures at that point to show what it pulled in.

The biggest thing that I learned in this process is that my width to height ratio is off. The roof of the trap should probably be another 2 feet wide for as tall as it is. I still think that it will work but not as good as it probably could. If anyone else has any experience or tips in building traps I would love to hear about it.

Deep Phylogeny of Coleoptera

2010-03-30T01:00:00.005-05:00

Welcome to the inaugural post of the Coleopterists Corner. Over the coming weeks and months this blog will document my experiences as I begin graduate school and work on becoming a well informed and professional coleopterist. Frequently I will use this site to review interesting Coleoptera, systematics, and evolution literature. I am working my way through years of articles so some of these will be new but many will be older articles that I am reading for the first time. Towards that end I would like to bring everyone's attention to a fascinating article in the journal Cladistics.

F. Friedrich , B.D. Farrell , R.G. Beutel. 2009. The thoracic morphology of Archostemata and the relationships of the extant suborders of Coleoptera (Hexapoda). Cladistics 25(1) 1-37.

I will warn you that the first 30 pages of this article contain a very detailed discussion of the anatomy of the Ommatid beetle Tetraphalerus bruchii and descriptions of the 117 characters considered. However following this is a cogent discussion of the very early evolution of Coleoptera. The results of the study suggest a branching pattern of: Archostemata + (Adephaga + [Myxophaga + Polyphaga]). Furthermore the authors do such a good job of explaining the distribution of traits that you feel that it is an intuitive phylogeny rather than a strict character analysis. The last part of this article is especially interesting as the authors discuss the very earliest stages of Coleoptera evolution and then go on to describe some of the reasons that Archostemata may have declined beginning in the late Mesozoic. As someone who is just beginning to study the literature on the deep phylogeny of Coleoptera, this article is especially helpful since the authors discuss and reference a number of important past studies.

There is a pdf version of the full article on Dr. Farrell website at: http://insects.oeb.harvard.edu/farrell_lab/publications/biblio.html

The authors of this paper are participating in the Beetle Tree of Life Project. This project has various aims but one of the most interesting is to produce a robust phylogenetic hypothesis for the families and subfamilies of Coleoptera. To read more about this project you can go to the main page of the project at http://insects.oeb.harvard.edu/ATOL/