Duplications of a short segment of a chromosome are frequent events and can have important fitness impacts. When a duplication first occurs it creates two regions on the chromosome that are homologous to the original duplicated region. Having multiple areas of homology increases the probability that processes like unequal crossing over will occur and thus the future stability of the region. Segmental duplications have also been associated with disease phenotypes like autism.Inversions and translocations have similar effects in reducing the ability of chromosomes to recombine with their homologous partners. Because of this both of these types of changes may increase the propensity for divergence to occur in the effected regions. This could be especially important when we begin to consider adaptation to the environment and how to avoid being swamped by the original genotype.
Spotting an inversion when you are looking at a DNA sequence isn't as easy as just looking for something that is backwards in comparison to the reference sequence. If this is our reference sequence:
ACCATCGCTATCACAGAGTCAAC
and the red portion undergoes an inversion it will not produce the sequence you might first expect:
ACCATGAGACACTATCGCTCAAC
This would require that 3' ends be joined together which is not possible. Instead the red portion that is being inverted will be replaced by the inverted complimentary sequence. Our new sequence then will be:
ACCATCTCTGTGATAGCGTCAAC
Translocations can have a major impact on the fitness of an organism since some gametes can have multiple copies of a gene while others may not have any copies of a gene. The ability of translocations to produce gene duplication is extremely important since we now know that gene duplication is probably the primary source for new genes.
No comments:
Post a Comment